Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T22939 |
Target Info
|
| Target Name |
Progesterone receptor (PGR) |
| Synonyms |
PR; Nuclear receptor subfamily 3 group C member 3; NR3C3 |
| Target Type |
Successful Target |
| Gene Name |
PGR |
| Biochemical Class |
Nuclear hormone receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-126-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucguaccgugaguaauaaugcg
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot; RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Adrenomedullin (ADM)
|
Target Info
|
|
|
Angiopoietin 1 receptor (TEK)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-378a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acuggacuuggagucagaaggc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Overexpression of pre-mir-378 resulted in decreased mRNA level of PGR. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Aromatase (CYP19A1)
|
Target Info
|
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-126-3p regulates progesterone receptors and involves development and lactation of mouse mammary gland. Mol Cell Biochem. 2011 Sep;355(1-2):17-25.
|
| REF 2 |
MicroRNA-378 regulates oocyte maturation via the suppression of aromatase in porcine cumulus cells. Am J Physiol Endocrinol Metab. 2015 Mar 15;308(6):E525-34.
|
| REF 3 |
Progesterone receptor expression in granulosa cells is suppressed by microRNA-378-3p. Mol Cell Endocrinol. 2015 Jan 5;399:95-102.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
