Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22117 Target Info
Target Name Macrophage-derived chemokine (MDC)
Synonyms Stimulated T-cell chemotactic protein 1; Stimulated T cell chemotactic protein1; Small-inducible cytokine A22; SCYA22; MDC(1-69); CC chemokine STCP-1; C-C motif chemokine 22; A-152E5.1
Target Type Literature-reported Target
Gene Name CCL22
Biochemical Class Cytokine: CC chemokine
UniProt ID
O00626
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The primary target of miR-34a in PVTT cells Is the chemokine gene CCL22. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 TGF--miR-34a-CCL22 signaling-induced Treg cell recruitment promotes venous metastases of HBV-positive hepatocellular carcinoma. Cancer Cell. 2012 Sep 11;22(3):291-303.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.