Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T21715 Target Info
Target Name RNA-binding protein Musashi-1 (MSI1)
Synonyms RNA-binding protein Musashi homolog 1; Musashi-1
Target Type Literature-reported Target
Gene Name MSI1
UniProt ID
O43347
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-330-3p miRNA Info
miRNA Mature AC
MIMAT0000751
Sequence gcaaagcacacggccugcagaga
miRNA Species Homo sapiens
Regulation Mechanism MSI1 is a direct target gene of miR-330-3p in gastric cancer cell. Overexpression of miR-330-3p promoted E-cadherin expression and inhibited the expression of N-cadherin, vimentin and snail. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
References  Top
REF 1 MiR-330-3p inhibits gastric cancer progression through targeting MSI1. Am J Transl Res. 2016 Nov 15;8(11):4802-4811.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.