Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T20808 Target Info
Target Name Isocitrate dehydrogenase (IDH)
Synonyms Isocitrate dehydrogenase [NAD]
Target Type Successful Target
Gene Name IDH1; IDH2; IDH3A; IDH3B; IDH3G
Biochemical Class CH-OH donor oxidoreductase
UniProt ID
O75874; P48735; P50213; O43837; P51553
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Regulation Mechanism miR-183 directly targets IDH2. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
References  Top
REF 1 MicroRNA-183 upregulates HIF-1 by targeting isocitrate dehydrogenase 2 (IDH2) in glioma cells. J Neurooncol. 2013 Feb;111(3):273-83.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.