Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T20629 Target Info
Target Name Adrenomedullin (ADM)
Synonyms AM; ADM
Target Type Clinical trial Target
Gene Name ADM
Biochemical Class Adrenomedullin
UniProt ID
P35318
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
References  Top
REF 1 Repression of miR-126 and upregulation of adrenomedullin in the stromal endothelium by cancer-stromal cross talks confers angiogenesis of cervical cancer. Oncogene. 2014 Jul 10;33(28):3636-47.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.