Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T20401 |
Target Info
|
| Target Name |
Carbonic anhydrase II (CA-II) |
| Synonyms |
Carbonic anhydrase C; Carbonic anhydrase 2; Carbonate dehydratase II; CAC |
| Target Type |
Successful Target |
| Gene Name |
CA2 |
| Biochemical Class |
Alpha-carbonic anhydrase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-23b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuaccac
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
A luciferase reporter fused to the 3'untranslated region (UTR) of CA-II was repressed by miR-23b transfection in mouse C2C12 myoblast cells, and this repression was abolished when the miR-23b seed-complementary sequence was mutated. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Carbonic anhydrase II (CA-II)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Carbonic anhydrase activation is associated with worsened pathological remodeling in human ischemic diabetic cardiomyopathy. J Am Heart Assoc. 2014 Mar 26;3(2):e000434.
|
| REF 2 |
Downregulated miR-23b-3p expression acts as a predictor of hepatocellular carcinoma progression: A study based on public data and RT-qPCR verificat... Int J Mol Med. 2018 May;41(5):2813-2831.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
