Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T18904 |
Target Info
|
| Target Name |
Lysine-specific demethylase 4A (KDM4A) |
| Synonyms |
KIAA0677; Jumonji domain-containing protein 2A; JmjC domain-containing histone demethylation protein 3A; JMJD2A; JMJD2; JHDM3A |
| Target Type |
Patented-recorded Target |
| Gene Name |
KDM4A |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggcagugucuuagcugguugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
JMJD2A knockdown induces cellular apoptosis through, at least in part, by regulating miR-34a expression. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Androgen receptor (AR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
JMJD2A predicts prognosis and regulates cell growth in human gastric cancer. Biochem Biophys Res Commun. 2014 Jun 20;449(1):1-7.
|
| REF 2 |
Epigenetic regulation of miR-34a expression in alcoholic liver injury. Am J Pathol. 2012 Sep;181(3):804-17.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
