Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T18474 Target Info
Target Name Ephrin type-A receptor 5 (EPHA5)
Synonyms hEK7; EPH-like kinase 7; EPH homology kinase 1; EK7; EHK1; EHK-1; Brain-specific kinase; BSK
Target Type Literature-reported Target
Gene Name EPHA5
Biochemical Class Kinase
UniProt ID
P54756
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a targets EphA5. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 MicroRNA-34a regulates migration of chondroblast and IL-1-induced degeneration of chondrocytes by targeting EphA5. Biochem Biophys Res Commun. 2011 Dec 2;415(4):551-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.