Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16042 Target Info
Target Name Arachidonate 15-lipoxygenase (15-LOX)
Synonyms LOG15; Arachidonate omega-6 lipoxygenase; Arachidonate 12-lipoxygenase, leukocyte-type; 15-Lipoxygenase; 15-LOX-1; 12/15-lipoxygenase; 12-LOX
Target Type Patented-recorded Target
Gene Name ALOX15
Biochemical Class Oxygenase
UniProt ID
P16050
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.