Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T15823 Target Info
Target Name Breast cancer type 2 susceptibility protein (BRCA2)
Synonyms Fanconi anemia group D1 protein; FANCD1; FACD
Target Type Literature-reported Target
Gene Name BRCA2
UniProt ID
P51587
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a could bind to the 3'UTR of BRCA2 messenger RNAs (mRNAs) and potentially modulate their mRNA expression. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-1245a miRNA Info
miRNA Mature AC
MIMAT0005897
Sequence aagugaucuaaaggccuacau
miRNA Species Homo sapiens
Regulation Mechanism BRCA2 is a target of miR-1245. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Breast cancer type 2 susceptibility protein (BRCA2) Target Info
BRCA2_HUMAN
References  Top
REF 1 A functional polymorphism in the miR-146a gene and age of familial breast/ovarian cancer diagnosis. Carcinogenesis. 2008 Oct;29(10):1963-6.
REF 2 miR-17-5p promotes the growth of osteosarcoma in a BRCC2-dependent mechanism. Oncol Rep. 2016 Mar;35(3):1473-82.
REF 3 Up-regulation of miR-1245 by c-myc targets BRCA2 and impairs DNA repair. J Mol Cell Biol. 2012 Apr;4(2):108-17.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.