Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T14755 |
Target Info
|
| Target Name |
TNF related activation protein (CD40LG) |
| Synonyms |
Tumor necrosis factor ligand superfamily member 5; TRAP; TNFSF5; TNF-related activation protein; T-cell antigen Gp39; T cell antigen Gp39; CD40L; CD40-L; CD40 ligand; CD154 antigen; CD154 |
| Target Type |
Clinical trial Target |
| Gene Name |
CD40LG |
| Biochemical Class |
Cytokine: tumor necrosis factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-146a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagaacugaauuccauggguu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activation B7-1 antigen (CD80)
|
Target Info
|
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-146a regulates the maturation process and pro-inflammatory cytokine secretion by targeting CD40L in oxLDL-stimulated dendritic cells. FEBS Lett. 2011 Feb 4;585(3):567-73.
|
| REF 2 |
Extracellular MicroRNA Signature of Human Helper T Cell Subsets in Health and Autoimmunity. J Biol Chem. 2017 Feb 17;292(7):2903-2915.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
