Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T14110 |
Target Info
|
| Target Name |
Beta-klotho (KLB) |
| Synonyms |
Klotho beta-like protein; BetaKlotho; BKL |
| Target Type |
Clinical trial Target |
| Gene Name |
KLB |
| Biochemical Class |
Glycosylase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggcagugucuuagcugguugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-34a Directly Targets BKL. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
|
Androgen receptor (AR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-34a and Impaired FGF19/21 Signaling in Obesity. Vitam Horm. 2016;101:175-96.
|
| REF 2 |
Aberrantly elevated microRNA-34a in obesity attenuates hepatic responses to FGF19 by targeting a membrane coreceptor -Klotho. Proc Natl Acad Sci U S A. 2012 Oct 2;109(40):16137-42.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
