Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T12974 |
Target Info
|
| Target Name |
High-mobility group protein B2 (HMGB2) |
| Synonyms |
High mobility group protein B2; High mobility group protein 2; HMG2; HMG-2 |
| Target Type |
Literature-reported Target |
| Gene Name |
HMGB2 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-23a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuucc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
DNA topoisomerase I (TOP1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-23b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuaccac
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[3] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
|
Carbonic anhydrase II (CA-II)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Kaposi's sarcoma-associated herpesvirus encodes a mimic of cellular miR-23. J Virol. 2013 Nov;87(21):11821-30.
|
| REF 2 |
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
|
| REF 3 |
miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2. Cell Death Dis. 2015 May 21;6:e1766.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
