Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T10491 Target Info
Target Name C-X-C chemokine receptor type 7 (ACKR3)
Synonyms RDC1; RDC-1; Gprotein coupled receptor RDC1 homolog; Gprotein coupled receptor 159; GPR159; G-protein coupled receptor RDC1 homolog; G-protein coupled receptor 159; Chemokine orphan receptor 1; CXCR7; CXCR-7; CXC-R7; CXC chemokine receptor type 7; CMKOR1; Atypical chemokine receptor 3
Target Type Preclinical Target
Gene Name ACKR3
Biochemical Class GPCR rhodopsin
UniProt ID
P25106
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism ACKR3 is a direct target gene of miR-100. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
References  Top
REF 1 miR-100 suppresses the proliferation and tumor growth of esophageal squamous cancer cells via targeting CXCR7. Oncol Rep. 2016 Jun;35(6):3453-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.