Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T08499 Target Info
Target Name Caterpiller protein 1.1 (NLRP3)
Synonyms PYRIN-containing APAF1-like protein 1; PYPAF1; NALP3; NACHT, LRR and PYD domains-containing protein 3; Cryopyrin; Cold-induced autoinflammatory syndrome 1 protein; CLR1.1; CIAS1; C1orf7; Angiotensin/vasopressin receptor AII/AVP-like
Target Type Clinical trial Target
Gene Name NLRP3
UniProt ID
Q96P20
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
References  Top
REF 1 The RNA-binding protein Tristetraprolin (TTP) is a critical negative regulator of the NLRP3 inflammasome. J Biol Chem. 2017 Apr 28;292(17):6869-6881.
REF 2 Myeloid-derived miR-223 regulates intestinal inflammation via repression of the NLRP3 inflammasome. J Exp Med. 2017 Jun 5;214(6):1737-1752.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.