Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T07533 |
Target Info
|
| Target Name |
Apolipoprotein B-100 (APOB) |
| Synonyms |
Apolipoprotein B48; Apo B48; Apo B100; Apo B-100 |
| Target Type |
Clinical trial Target |
| Gene Name |
APOB |
| Biochemical Class |
Apolipoprotein |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-548p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcaaaaacugcaguuacuuu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-548p reduced and anti-548p increased luciferase activity in cells transfected with luciferase containing wild-type APOB 3'UTR suggesting that miR-548p interacts with 3'UTR of APOB. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunoprecipitation; Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apolipoprotein B-100 (APOB)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Human MicroRNA-548p Decreases Hepatic Apolipoprotein B Secretion and Lipid Synthesis. Arterioscler Thromb Vasc Biol. 2017 May;37(5):786-793.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
