Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07247 Target Info
Target Name Calgranulin D (S100A12)
Synonyms S100 calcium-binding protein A12; Protein S100-A12; P6; Neutrophil S100 protein; Migration inhibitory factor-related protein 6; MRP-6; Extracellular newly identified RAGE-binding protein; EN-RAGE; Calgranulin-C; Calcium-binding protein in amniotic fluid 1; CGRP; CAGC; CAAF1
Target Type Clinical trial Target
Gene Name S100A12
Biochemical Class S100 calcium-binding protein
UniProt ID
P80511
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
References  Top
REF 1 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.