Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T04499 Target Info
Target Name Kinase suppressor of Ras-1 (KSR1)
Synonyms Kinase suppressor of Ras 1; KSR
Target Type Literature-reported Target
Gene Name KSR1
Biochemical Class Kinase
UniProt ID
Q13476
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 MiR-378 controls cardiac hypertrophy by combined repression of mitogen-activated protein kinase pathway factors. Circulation. 2013 May 28;127(21):2097-106.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.