Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T04499 |
Target Info
|
Target Name |
Kinase suppressor of Ras-1 (KSR1) |
Synonyms |
Kinase suppressor of Ras 1; KSR |
Target Type |
Literature-reported Target |
Gene Name |
KSR1 |
Biochemical Class |
Kinase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-378a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acuggacuuggagucagaaggc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
Representative Target(s) Regulated by This miRNA |
Aromatase (CYP19A1)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
References |
Top |
REF 1 |
MiR-378 controls cardiac hypertrophy by combined repression of mitogen-activated protein kinase pathway factors. Circulation. 2013 May 28;127(21):2097-106.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.