Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T03634 Target Info
Target Name CREB-binding protein (CREBBP)
Synonyms CREBbinding protein; CBP
Target Type Clinical trial Target
Gene Name CREBBP
Biochemical Class Acyltransferase
UniProt ID
Q92793
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-324-3p miRNA Info
miRNA Mature AC
MIMAT0000762
Sequence cccacugccccaggugcugcugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
CREB-binding protein (CREBBP) Target Info
CBP_HUMAN
References  Top
REF 1 Transcriptome-wide prediction of miRNA targets in human and mouse using FASTH. PLoS One. 2009 May 29;4(5):e5745.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.