Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T02318 | Target Info | |||
| Target Name | B-cell-activating factor (TNFSF13B) | ||||
| Synonyms | ZTNF4; UNQ401/PRO738; Tumor necrosis factor ligand superfamily member 13B; TNFSF20; TNF-and APOL-related leukocyte expressed ligand 1; TNF- and APOL-related leukocyte expressed ligand 1; TALL1; TALL-1; Dendritic cell-derived TNF-like molecule; CD257; BLyS; BAFF; B lymphocyte stimulator; B cell-activating factor | ||||
| Target Type | Successful Target | ||||
| Gene Name | TNFSF13B | ||||
| Biochemical Class | Cytokine: tumor necrosis factor | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-202-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | agagguauagggcaugggaa | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-202 inhibited the proliferation of MM cells by targeting TNFSF13B. | [1] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| Representative Target(s) Regulated by This miRNA | B-cell-activating factor (TNFSF13B) | Target Info | |||
| LDL receptor related protein-6 (LRP-6) | Target Info | ||||
| miRNA Mature ID | hsa-miR-202-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuccuaugcauauacuucuuug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-202 inhibited the proliferation of MM cells by targeting TNFSF13B. | [2] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | ELISA; Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | B-cell-activating factor (TNFSF13B) | Target Info | |||
| TGF-beta receptor type I (TGFBR1) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Study on the Association Between miRNA-202 Expression and Drug Sensitivity in Multiple Myeloma Cells. Pathol Oncol Res. 2016 Jul;22(3):531-9. | ||||
| REF 2 | miRNA-202 in bone marrow stromal cells affects the growth and adhesion of multiple myeloma cells by regulating B cell-activating factor. Clin Exp Med. 2016 Aug;16(3):307-16. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.