miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-95-5p | ||||
miRNA Stemloop AC | MI0000097 | ||||
miRNA Stemloop ID | hsa-mir-95 | ||||
Sequence | ucaauaaaugucuguugaauu | ||||
TTD Target(s) Regulated by This miRNA | Estrogen receptor beta (ESR2) | Successful Target | Target Info | [1] | |
References | |||||
REF 1 | Calycosin induces apoptosis in colorectal cancer cells, through modulating the ER/MiR-95 and IGF-1R, PI3K/Akt signaling pathways. Gene. 2016 Oct 10;591(1):123-128. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.