miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-944 | ||||
| miRNA Stemloop AC | MI0005769 | ||||
| miRNA Stemloop ID | hsa-mir-944 | ||||
| Sequence | aaauuauuguacaucggaugag | ||||
| TTD Target(s) Regulated by This miRNA | Protein tyrosine phosphatase IVA 1 (PRL-1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | E3 ubiquitin-protein ligase HECW2 | Regulated Protein | [2] | ||
| E3 ubiquitin-protein ligase SIAH1 | Regulated Protein | [1] | |||
| S100P-binding protein | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | Suppression of cell migration is promoted by miR-944 through targeting of SIAH1 and PTP4A1 in breast cancer cells. BMC Cancer. 2016 Jul 4;16:379. | ||||
| REF 2 | Novel functions and targets of miR-944 in human cervical cancer cells.Int J Cancer. 2015 Mar 1;136(5):E230-41. | ||||
| REF 3 | Suppression of cell migration is promoted by miR-944 through targeting of SIAH1 and PTP4A1 in breast cancer cells. BMC Cancer. 2016 Jul 4;16:379. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.