miRNA General Information
miRNA Mature ID	hsa-miR-92a-3p
miRNA Stemloop AC	MI0000093 | MI0000094
miRNA Stemloop ID	hsa-mir-92a-1 | hsa-mir-92a-2
Sequence	uauugcacuugucccggccugu
TTD Target(s) Regulated by This miRNA	Integrin alpha-5 (ITGA5)	Clinical trial Target	Target Info	[1]
Protein(s) Regulated by This miRNA	AT-rich interactive domain-containing protein 4B	Regulated Protein	ARI4B_HUMAN	[2]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[3]
	C-C motif chemokine 8	Regulated Protein	CCL8_HUMAN	[4]
	Cytoplasmic polyadenylation element-binding protein 2	Regulated Protein	CPEB2_HUMAN	[5]
	DNA-binding protein Ikaros	Regulated Protein	IKZF1_HUMAN	[6]
	Double-strand-break repair protein rad21 homolog	Regulated Protein	RAD21_HUMAN	[7]
	Dual specificity mitogen-activated protein kinase kinase 4	Regulated Protein	MP2K4_HUMAN	[8]
	E3 ubiquitin-protein ligase MYCBP2	Regulated Protein	MYCB2_HUMAN	[9]
	E3 ubiquitin-protein ligase MYLIP	Regulated Protein	MYLIP_HUMAN	[2]
	E3 ubiquitin-protein ligase rififylin	Regulated Protein	RFFL_HUMAN	[10]
	Homeodomain-interacting protein kinase 1	Regulated Protein	HIPK1_HUMAN	[11]
	Homeodomain-interacting protein kinase 3	Regulated Protein	HIPK3_HUMAN	[2]
	Krueppel-like factor 2	Regulated Protein	KLF2_HUMAN	[12]
	Krueppel-like factor 2	Regulated Protein	KLF2_HUMAN	[13]
	LIM and SH3 domain protein 1	Regulated Protein	LASP1_HUMAN	[14]
	Microtubule-associated protein RP/EB family member 1	Regulated Protein	MARE1_HUMAN	[10]
	Oxysterol-binding protein-related protein 2	Regulated Protein	OSBL2_HUMAN	[10]
	Oxysterol-binding protein-related protein 8	Regulated Protein	OSBL8_HUMAN	[10]
	PH domain leucine-rich repeat-containing protein phosphatase 1	Regulated Protein	PHLP1_HUMAN	[15]
	Polycomb group RING finger protein 5	Regulated Protein	PCGF5_HUMAN	[10]
	Protein CASC10	Regulated Protein	CSC10_HUMAN	[10]
	Regulator of G-protein signaling 5	Regulated Protein	RGS5_HUMAN	[16]
	Suppressor of cytokine signaling 5	Regulated Protein	SOCS5_HUMAN	[17]
	Tumor protein 63	Regulated Protein	P63_HUMAN	[18]
References
REF 1	MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 2009 Jun 26;324(5935):1710-3.
REF 2	Oncogenic potential of the miR-106-363 cluster and its implication in human T-cell leukemia.Cancer Res. 2007 Jun 15;67(12):5699-707.
REF 3	MiR-92a mediates AZD6244 induced apoptosis and G1-phase arrest of lymphoma cells by targeting Bim.Cell Biol Int. 2014 Apr;38(4):435-43.
REF 4	Latency-associated viral interleukin-10 (IL-10) encoded by human cytomegalovirus modulates cellular IL-10 and CCL8 Secretion during latent infection through changes in the cellular microRNA hsa-miR-92a.J Virol. 2014 Dec;88(24):13947-55.
REF 5	CPEB2, CPEB3 and CPEB4 are coordinately regulated by miRNAs recognizing conserved binding sites in paralog positions of their 3'-UTRs.Nucleic Acids Res. 2010 Nov;38(21):7698-710.
REF 6	Mir-17-92 regulates bone marrow homing of plasma cells and production of immunoglobulin G2c.Nat Commun. 2015 Apr 17;6:6764.
REF 7	The regulatory and predictive functions of miR-17 and miR-92 families on cisplatin resistance of non-small cell lung cancer. BMC Cancer. 2015 Oct 19;15:731.
REF 8	miR-92a inhibits vascular smooth muscle cell apoptosis: role of the MKK4-JNK pathway.Apoptosis. 2014 Jun;19(6):975-83.
REF 9	miR-92a-3p and MYCBP2 are involved in MS-275-induced and c-myc-mediated TRAIL-sensitivity in melanoma cells.Int Immunopharmacol. 2016 Nov;40:235-243.
REF 10	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding.Cell. 2013 Apr 25;153(3):654-65.
REF 11	MiR-19b/20a/92a regulates the self-renewal and proliferation of gastric cancer stem cells. J Cell Sci. 2013 Sep 15;126(Pt 18):4220-9.
REF 12	Flow-Dependent Regulation of Kruppel-Like Factor 2 Is Mediated by MicroRNA-92a.Circulation. 2011 Aug 2;124(5):633-41.
REF 13	Inhibition of MiR-92a May Protect Endothelial Cells After Acute Myocardial Infarction in Rats: Role of KLF2/4.Med Sci Monit. 2016 Jul 14;22:2451-62.
REF 14	MicroRNA-29a plays a suppressive role in non-small cell lung cancer cells via targeting LASP1. Onco Targets Ther. 2016 Nov 14;9:6999-7009.
REF 15	The miRNA-17 2 cluster mediates chemoresistance and enhances tumor growth in mantle cell lymphoma via PI3K/AKT pathway activation.Leukemia. 2012 May;26(5):1064-72.
REF 16	Focal DNA copy number changes in neuroblastoma target MYCN regulated genes.PLoS One. 2013;8(1):e52321.
REF 17	Inhibition of microRNA-92a prevents endothelial dysfunction and atherosclerosis in mice.Circ Res. 2014 Jan 31;114(3):434-43.
REF 18	The microRNA miR-92 increases proliferation of myeloid cells and by targeting p63 modulates the abundance of its isoforms.FASEB J. 2009 Nov;23(11):3957-66.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.