miRNA General Information
miRNA Mature ID	hsa-miR-802
miRNA Stemloop AC	MI0003906
miRNA Stemloop ID	hsa-mir-802
Sequence	caguaacaaagauucauccuugu
TTD Target(s) Regulated by This miRNA	Methyl cpg binding protein 2 (MECP2)	Clinical trial Target	Target Info	[1]
References
REF 1	Chromosome 21-derived microRNAs provide an etiological basis for aberrant protein expression in human Down syndrome brains. J Biol Chem. 2010 Jan 8;285(2):1529-43.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.