miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-766-3p | ||||
| miRNA Stemloop AC | MI0003836 | ||||
| miRNA Stemloop ID | hsa-mir-766 | ||||
| Sequence | acuccagccccacagccucagc | ||||
| TTD Target(s) Regulated by This miRNA | Hepatocyte nuclear factor 4-alpha (HNF4A) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Apoptosis regulator BAX | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | In silico and in vitro identification of microRNAs that regulate hepatic nuclear factor 4 expression. Drug Metab Dispos. 2012 Apr;40(4):726-33. | ||||
| REF 2 | MicroRNAs contribute to promyelocyte apoptosis in As2O3-treated APL cells.Cell Physiol Biochem. 2013;32(6):1818-29. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.