miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-761 | ||||
| miRNA Stemloop AC | MI0003941 | ||||
| miRNA Stemloop ID | hsa-mir-761 | ||||
| Sequence | gcagcagggugaaacugacaca | ||||
| TTD Target(s) Regulated by This miRNA | Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Mitofusin-2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-761 regulates the mitochondrial network by targeting mitochondrial fission factor. Free Radic Biol Med. 2013 Dec;65:371-379. | ||||
| REF 2 | MicroRNA-761 is upregulated in hepatocellular carcinoma and regulates tumorigenesis by targeting Mitofusin-2.Cancer Sci. 2016 Apr;107(4):424-32. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.