miRNA General Information
miRNA Mature ID hsa-miR-708-3p
miRNA Stemloop AC MI0005543
miRNA Stemloop ID hsa-mir-708
Sequence caacuagacugugagcuucuag
TTD Target(s) Regulated by This miRNA Thrombopoietin receptor (MPL) Successful Target Target Info [1]
Protein(s) Regulated by This miRNA NEDD4-binding protein 1 Regulated Protein [1]
Protein TEX261 Regulated Protein [1]
Ubiquitin thioesterase OTUB1 Regulated Protein [1]
References
REF 1 miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45.
REF 2 miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.