miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-708-3p | ||||
miRNA Stemloop AC | MI0005543 | ||||
miRNA Stemloop ID | hsa-mir-708 | ||||
Sequence | caacuagacugugagcuucuag | ||||
TTD Target(s) Regulated by This miRNA | Thrombopoietin receptor (MPL) | Successful Target | Target Info | [1] | |
Protein(s) Regulated by This miRNA | NEDD4-binding protein 1 | Regulated Protein | [1] | ||
Protein TEX261 | Regulated Protein | [1] | |||
Ubiquitin thioesterase OTUB1 | Regulated Protein | [1] | |||
References | |||||
REF 1 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
REF 2 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.