miRNA General Information
miRNA Mature ID	hsa-miR-634
miRNA Stemloop AC	MI0003649
miRNA Stemloop ID	hsa-mir-634
Sequence	aaccagcaccccaacuuuggac
TTD Target(s) Regulated by This miRNA	Cysteine-rich angiogenic inducer 61 (CYR61)	Literature-reported Target	Target Info	[1]
References
REF 1	Differential Effects of MicroRNAs on Glioblastoma Growth and Migration. Genes (Basel). 2013 Mar 4;4(1):46-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.