miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-631 | ||||
| miRNA Stemloop AC | MI0003645 | ||||
| miRNA Stemloop ID | hsa-mir-631 | ||||
| Sequence | agaccuggcccagaccucagc | ||||
| TTD Target(s) Regulated by This miRNA | Tyrosine-protein kinase ZAP-70 (ZAP-70) | Patented-recorded Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Sulfotransferase 1A1 | Regulated Protein | [2] | ||
| Ubiquitin-conjugating enzyme E2 C | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MiR-631/ZAP70: A novel axis in the migration and invasion of prostate cancer cells. Biochem Biophys Res Commun. 2016 Jan 15;469(3):345-51. | ||||
| REF 2 | Functional genetic variants in the 3'-untranslated region of sulfotransferase isoform 1A1 (SULT1A1) and their effect on enzymatic activity.Toxicol Sci. 2010 Dec;118(2):391-403. | ||||
| REF 3 | hsa-miR-631 resensitizes bortezomib-resistant multiple myeloma cell lines by inhibiting UbcH10.Oncol Rep. 2017 Feb;37(2):961-968. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.