miRNA General Information
miRNA Mature ID	hsa-miR-623
miRNA Stemloop AC	MI0003637
miRNA Stemloop ID	hsa-mir-623
Sequence	aucccuugcaggggcuguugggu
TTD Target(s) Regulated by This miRNA	X-ray repair cross-complementing 5 (Ku80)	Literature-reported Target	Target Info	[1]
References
REF 1	Hsa-miR-623 suppresses tumor progression in human lung adenocarcinoma. Cell Death Dis. 2016 Sep 29;7(9):e2388.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.