miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-593-5p | ||||
| miRNA Stemloop AC | MI0003605 | ||||
| miRNA Stemloop ID | hsa-mir-593 | ||||
| Sequence | aggcaccagccaggcauugcucagc | ||||
| TTD Target(s) Regulated by This miRNA | Polo-like kinase 1 (PLK1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Mitochondrial fission factor | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Polo-like kinase 1 regulates cell proliferation and is targeted by miR-593* in esophageal cancer. Int J Cancer. 2011 Nov 1;129(9):2134-46. | ||||
| REF 2 | Mitochondrial fission determines cisplatin sensitivity in tongue squamous cell carcinoma through the BRCA1-miR-593-5p-MFF axis.Oncotarget. 2015 Jun 20;6(17):14885-904. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.