miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-551a | ||||
| miRNA Stemloop AC | MI0003556 | ||||
| miRNA Stemloop ID | hsa-mir-551a | ||||
| Sequence | gcgacccacucuugguuucca | ||||
| TTD Target(s) Regulated by This miRNA | Protein tyrosine phosphatase IVA 3 (PRL-3) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Creatine kinase B-type | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-495 and miR-551a inhibit the migration and invasion of human gastric cancer cells by directly interacting with PRL-3. Cancer Lett. 2012 Oct 1;323(1):41-7. | ||||
| REF 2 | Extracellular metabolic energetics can promote cancer progression.Cell. 2015 Jan 29;160(3):393-406. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.