miRNA General Information
miRNA Mature ID	hsa-miR-526b-5p
miRNA Stemloop AC	MI0003150
miRNA Stemloop ID	hsa-mir-526b
Sequence	cucuugagggaagcacuuucugu
TTD Target(s) Regulated by This miRNA	X-ray repair cross-complementing 5 (Ku80)	Literature-reported Target	Target Info	[1]
References
REF 1	By downregulating Ku80, hsa-miR-526b suppresses non-small cell lung cancer. Oncotarget. 2015 Jan 30;6(3):1462-77.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.