miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-487a-3p | ||||
| miRNA Stemloop AC | MI0002471 | ||||
| miRNA Stemloop ID | hsa-mir-487a | ||||
| Sequence | aaucauacagggacauccaguu | ||||
| TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter G2 (ABCG2) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2 | Regulated Protein | [2] | ||
| Phosphatidylinositol 3-kinase regulatory subunit alpha | Regulated Protein | [3] | |||
| Sprouty-related, EVH1 domain-containing protein 2 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MiR-487a resensitizes mitoxantrone (MX)-resistant breast cancer cells (MCF-7/MX) to MX by targeting breast cancer resistance protein (BCRP/ABCG2). Cancer Lett. 2013 Oct 1;339(1):107-15. | ||||
| REF 2 | MiR-487a Promotes TGF-1-induced EMT, the Migration and Invasion of Breast Cancer Cells by Directly Targeting MAGI2.Int J Biol Sci. 2016 Feb 5;12(4):397-408. | ||||
| REF 3 | miRNA-487a Promotes Proliferation and Metastasis in Hepatocellular Carcinoma.Clin Cancer Res. 2017 May 15;23(10):2593-2604. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.