miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-4782-3p | ||||
miRNA Stemloop AC | MI0017427 | ||||
miRNA Stemloop ID | hsa-mir-4782 | ||||
Sequence | ugauugucuucauaucuagaac | ||||
TTD Target(s) Regulated by This miRNA | X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [1] | |
Ubiquitin carboxyl-terminal hydrolase 14 (USP14) | Preclinical Target | Target Info | [1] | ||
Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [1] | ||
References | |||||
REF 1 | MiR-4782-3p inhibited non-small cell lung cancer growth via USP14. Cell Physiol Biochem. 2014;33(2):457-67. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.