miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-450b-5p | ||||
miRNA Stemloop AC | MI0005531 | ||||
miRNA Stemloop ID | hsa-mir-450b | ||||
Sequence | uuuugcaauauguuccugaaua | ||||
TTD Target(s) Regulated by This miRNA | Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [1] | |
References | |||||
REF 1 | miR-450b-5p Suppresses Stemness and the Development of Chemoresistance by Targeting SOX2 in Colorectal Cancer. DNA Cell Biol. 2016 May;35(5):249-56. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.