miRNA General Information
miRNA Mature ID	hsa-miR-376a-5p
miRNA Stemloop AC	MI0000784
miRNA Stemloop ID	hsa-mir-376a-1
Sequence	guagauucuccuucuaugagua
TTD Target(s) Regulated by This miRNA	Dual specificity protein kinase TTK (MPS1)	Clinical trial Target	Target Info	[1]
	Monocarboxylate transporter 1 (SLC16A1)	Literature-reported Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Activin receptor type-1C	Regulated Protein	ACV1C_HUMAN	[3]
	E3 ubiquitin-protein ligase AMFR	Regulated Protein	AMFR_HUMAN	[4]
	Ras-related protein Rap-2a	Regulated Protein	RAP2A_HUMAN	[4]
	Ribose-phosphate pyrophosphokinase 1	Regulated Protein	PRPS1_HUMAN	[1]
	Serine/arginine-rich splicing factor 11	Regulated Protein	SRS11_HUMAN	[1]
	Sorting nexin-19	Regulated Protein	SNX19_HUMAN	[1]
	Zinc finger protein 513	Regulated Protein	ZN513_HUMAN	[1]
References
REF 1	Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. Science. 2007 Feb 23;315(5815):1137-40.
REF 2	Systematic identification of microRNA functions by combining target prediction and expression profiling. Nucleic Acids Res. 2006 Mar 20;34(5):1646-52. Print 2006.
REF 3	MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J Cell Sci. 2011 Feb 1;124(Pt 3):359-68.
REF 4	Attenuated adenosine-to-inosine editing of microRNA-376a* promotes invasiveness of glioblastoma cells.J Clin Invest. 2012 Nov;122(11):4059-76.
REF 5	Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. Science. 2007 Feb 23;315(5815):1137-40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.