miRNA General Information
miRNA Mature ID	hsa-miR-3686
miRNA Stemloop AC	MI0016087
miRNA Stemloop ID	hsa-mir-3686
Sequence	aucuguaagagaaaguaaauga
TTD Target(s) Regulated by This miRNA	Polo-like kinase 1 (PLK1)	Clinical trial Target	Target Info	[1]
References
REF 1	The MicroRNA3686 Inhibits the Proliferation of Pancreas Carcinoma Cell Line by Targeting the Polo-Like Kinase 1. Biomed Res Int. 2015;2015:954870.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.