miRNA General Information
miRNA Mature ID	hsa-miR-3619-5p
miRNA Stemloop AC	MI0016009
miRNA Stemloop ID	hsa-mir-3619
Sequence	ucagcaggcaggcuggugcagc
TTD Target(s) Regulated by This miRNA	Phospholipase D2 (PLD2)	Clinical trial Target	Target Info	[1]
References
REF 1	A Repertoire of MicroRNAs Regulates Cancer Cell Starvation by Targeting Phospholipase D in a Feedback Loop That Operates Maximally in Cancer Cells. Mol Cell Biol. 2016 Jan 19;36(7):1078-89.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.