miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-33b-3p | ||||
| miRNA Stemloop AC | MI0003646 | ||||
| miRNA Stemloop ID | hsa-mir-33b | ||||
| Sequence | cagugccucggcagugcagccc | ||||
| TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [1] | |
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Sal-like protein 4 | Regulated Protein | [2] | ||
| Twist-related protein 1 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | Clinical Significance of Determining Plasma MicroRNA33b in Type 2 Diabetic Patients with Dyslipidemia. J Atheroscler Thromb. 2016 Nov 1;23(11):1276-1285. | ||||
| REF 2 | MicroRNA-33b Inhibits Breast Cancer Metastasis by Targeting HMGA2, SALL4 and Twist1. Sci Rep. 2015 Apr 28;5:9995. | ||||
| REF 3 | MicroRNA-33b Inhibits Breast Cancer Metastasis by Targeting HMGA2, SALL4 and Twist1. Sci Rep. 2015 Apr 28;5:9995. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.