miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-29c-5p | ||||
| miRNA Stemloop AC | MI0000735 | ||||
| miRNA Stemloop ID | hsa-mir-29c | ||||
| Sequence | ugaccgauuucuccugguguuc | ||||
| TTD Target(s) Regulated by This miRNA | DNA [cytosine-5]-methyltransferase 3B (DNMT3B) | Clinical trial Target | Target Info | [1] | |
| DNA [cytosine-5]-methyltransferase 3A (DNMT3A) | Patented-recorded Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Cytoplasmic polyadenylation element-binding protein 4 | Regulated Protein | [2] | ||
| Protein Wnt-4 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MiR-29c regulates the expression of miR-34c and miR-449a by targeting DNA methyltransferase 3a and 3b in nasopharyngeal carcinoma. BMC Cancer. 2016 Mar 15;16:218. | ||||
| REF 2 | MicroRNA-29c-5p suppresses gallbladder carcinoma progression by directly targeting CPEB4 and inhibiting the MAPK pathway.Cell Death Differ. 2017 Mar;24(3):445-457. | ||||
| REF 3 | MicroRNA-29c overexpression inhibits proliferation and promotes apoptosis and differentiation in P19 embryonal carcinoma cells.Gene. 2016 Jan 15;576(1 Pt 2):304-11. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.