miRNA General Information
miRNA Mature ID hsa-miR-215-3p
miRNA Stemloop AC MI0000291
miRNA Stemloop ID hsa-mir-215
Sequence ucugucauuucuuuaggccaaua
TTD Target(s) Regulated by This miRNA Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [1]
References
REF 1 miR-215 promotes cell migration and invasion of gastric cancer cell lines by targeting FOXO1. Neoplasma. 2017;64(4):579-587.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.