miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-215-3p | ||||
miRNA Stemloop AC | MI0000291 | ||||
miRNA Stemloop ID | hsa-mir-215 | ||||
Sequence | ucugucauuucuuuaggccaaua | ||||
TTD Target(s) Regulated by This miRNA | Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [1] | |
References | |||||
REF 1 | miR-215 promotes cell migration and invasion of gastric cancer cell lines by targeting FOXO1. Neoplasma. 2017;64(4):579-587. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.