miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-210-5p | ||||
| miRNA Stemloop AC | MI0000286 | ||||
| miRNA Stemloop ID | hsa-mir-210 | ||||
| Sequence | agccccugcccaccgcacacug | ||||
| TTD Target(s) Regulated by This miRNA | Complement factor B (CFB) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Submaxillary gland androgen-regulated protein 3B | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Genetic variants in microRNAs and their binding sites within gene 3'UTRs associate with susceptibility to age-related macular degeneration. Hum Mutat. 2017 Jul;38(7):827-838. | ||||
| REF 2 | PRL-3 promotes gastric cancer migration and invasion through a NF-B-HIF-1-miR-210 axis.J Mol Med (Berl). 2016 Apr;94(4):401-15. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.