miRNA General Information
miRNA Mature ID	hsa-miR-181b-2-3p
miRNA Stemloop AC	MI0000683
miRNA Stemloop ID	hsa-mir-181b-2
Sequence	cucacugaucaaugaaugca
TTD Target(s) Regulated by This miRNA	Toll-like receptor 4 (TLR4)	Clinical trial Target	Target Info	[1]
References
REF 1	MicroRNA-181b negatively regulates the proliferation of human epidermal keratinocytes in psoriasis through targeting TLR4. J Cell Mol Med. 2017 Feb;21(2):278-285.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.