miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-147a | ||||
| miRNA Stemloop AC | MI0000262 | ||||
| miRNA Stemloop ID | hsa-mir-147 | ||||
| Sequence | guguguggaaaugcuucugc | ||||
| TTD Target(s) Regulated by This miRNA | Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Activin receptor type-1C | Regulated Protein | [2] | ||
| Cytochrome c oxidase subunit NDUFA4 | Regulated Protein | [3] | |||
| Cytochrome P450 2S1 | Regulated Protein | [4] | |||
| DNA replication licensing factor MCM3 | Regulated Protein | [3] | |||
| Hypoxia-inducible factor 3-alpha | Regulated Protein | [5] | |||
| Proteasome subunit alpha type-3 | Regulated Protein | [3] | |||
| Solute carrier family 22 member 3 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 2 | MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J Cell Sci. 2011 Feb 1;124(Pt 3):359-68. | ||||
| REF 3 | Seed-Milarity confers to hsa-miR-210 and hsa-miR-147b similar functional activity. PLoS One. 2012;7(9):e44919. | ||||
| REF 4 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 5 | A novel hypoxia-induced miR-147a regulates cell proliferation through a positive feedback loop of stabilizing HIF-1.Cancer Biol Ther. 2016 Aug 2;17(8):790-8. | ||||
| REF 6 | Functional Variant in the SLC22A3-LPAL2-LPA Gene Cluster Contributes to the Severity of Coronary Artery Disease.Arterioscler Thromb Vasc Biol. 2016 Sep;36(9):1989-96. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.