miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-146b-3p | ||||
| miRNA Stemloop AC | MI0003129 | ||||
| miRNA Stemloop ID | hsa-mir-146b | ||||
| Sequence | gcccuguggacucaguucuggu | ||||
| TTD Target(s) Regulated by This miRNA | Platelet-derived growth factor B (PDGFB) | Clinical trial Target | Target Info | [1] | |
| IL-1 receptor-associated kinase 1 (IRAK1) | Patented-recorded Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Neuronal PAS domain-containing protein 4 | Regulated Protein | [2] | ||
| Period circadian protein homolog 1 | Regulated Protein | [2] | |||
| S-adenosylmethionine synthase isoform type-2 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | PDGF induced microRNA alterations in cancer cells. Nucleic Acids Res. 2011 May;39(10):4035-47. | ||||
| REF 2 | The BDNF Val66Met variant affects gene expression through miR-146b. Neurobiol Dis. 2015 May;77:228-37. | ||||
| REF 3 | The BDNF Val66Met variant affects gene expression through miR-146b. Neurobiol Dis. 2015 May;77:228-37. | ||||
| REF 4 | Induction of methionine adenosyltransferase 2A in tamoxifen-resistant breast cancer cells.Oncotarget. 2016 Mar 22;7(12):13902-16. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.